Tutorial

Prompt Splicify
with a design request.

Describe what you want to build in plain language, attach any GenBank files you have, and Splicify picks the best workflow. The chat is the front door for designing plasmids; the plasmid viewer is where you inspect and edit them. This page walks through both.

How a chat request flows

Every prompt you send hits a single endpoint, /api/chat, that runs five deterministic steps before any cloning workflow executes. You don’t need to know the internals to use it — but a quick look at the path explains why certain phrasings get certain results.

The five steps behind every prompt

01
Sequence extraction — any DNA pasted in the message is pulled out and replaced with placeholders so the rest of the pipeline can read your intent without choking on long bases.
02
Intent classification — a deterministic keyword + regex matcher picks one of nine intents (Gibson, Gateway, Golden Gate, sgRNA Golden Gate, restriction, SDM, annotate, describe-a-plasmid, unknown). No LLM is called here.
03
KB pre-resolution — feature names you mentioned (CMV, eGFP, AmpR, His-tag, …) are matched against the in-house knowledge base, so handlers downstream get pre-resolved sequences instead of guessing.
04
Unified predesign — for assembly intents, parts are resolved, every part is annotated once (cached by sequence hash), the assembled target is annotated at module-level, and the workflow is scored against the abstract spec of what you asked for.
05
Per-intent handler — runs the actual designer (Primer3, Gibson, Golden Gate, Gateway operator, …), builds the response, and re-annotates the final plasmid with the full pipeline so the viewer shows every feature.

Phrasing that triggers each workflow

The classifier reads your prompt and the files you attach, then picks an intent. You don’t have to memorise the rules — but if you want a specific workflow, phrase the request to match.

WorkflowTriggersWhat you upload
Gibson assembly“Gibson assembly”, “assemble these fragments”, two or more sequences in the promptNone — fragments are pasted inline
Gateway cloning“Gateway”, “BP reaction”, “LR reaction”, “attB/attP/attL/attR”, “pDONR”Vector and/or insert .gb files
Golden Gate primers“Golden Gate primers”, “BsaI/BsmBI primers”, multi-fragment language with “+” separatorsOptional — sequences inline
sgRNA Golden Gate“sgRNA” or “gRNA” + “Golden Gate” / “BsmBI” / “lentiCRISPR” / “pX330”CRISPR vector .gb file
Restriction cloning“clone X into Y”, “restriction enzyme/digest cloning”, named Type II enzymes (EcoRI, HindIII, …)Backbone .gb file (optional)
Site-directed mutagenesis“mutate”, “delete the X”, “Y66H”, “point mutation”, “remove the NLS”Plasmid .gb file (target or inventory)
Annotate plasmid“annotate”, “identify features”Plasmid .gb file
Describe a plasmid“make / build / design a vector for X”, “I need a plasmid that …”None

Supported workflows

Gibson assemblyBuild from synthesised or PCR fragments.
Gateway cloningBP / LR entry and destination vectors.
Golden GateBsaI / BsmBI with scar-free junctions.
sgRNA Golden GateCRISPR oligos into lentiCRISPR v2.
Restriction cloningInsert + vector with site selection.
Site-directed mutagenesisPoint mutations, insertions, deletions.
Plasmid annotationBetaSix-tier feature identification.
Describe-a-plasmidBetaNatural-language design via semantic retrieval.

Example 1 — Gibson from fragments

Paste fragment sequences directly in the prompt. Splicify designs primers with homology overhangs at every junction and returns a full assembly + protocol.

Design gibson assembly primers for assembling a plasmid with these fragments: Frag1: GCCTCCTGCTGGTCCCAAGTTGTGAAATCTTTATCG…, Frag2: CTTGCCTTCACCTTTACCCTCGATCGTAAAATCATG…, Frag3: TCCACTATTCGAGGCCGTTCGTTAATACTTGTTGCG…, frag4: GCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC…

What you'll get back

  • Circular construct visualisation showing fragments, overlaps, and primers
  • Primer CSV — sequences, Tm, GC%, secondary structures, quality scores
  • Overlap CSV — sequence, length, Tm, quality scores
  • Junction table with overlap homology and Tm per junction
  • Annotated GenBank of the assembled construct
  • Expert explanation — potential issues and optimisation tips

Example 2 — Golden Gate primers

Multi-fragment Golden Gate primer design: Splicify picks orthogonal 4 bp overhangs, tails BsaI / BsmBI / BbsI sites onto every primer, and verifies no Type IIs site appears inside any fragment.

Design Golden Gate primers to assemble EF1a promoter + eGFP + bGH polyA terminator.

Example 3 — Restriction cloning

Upload your backbone and ask Splicify to clone an insert into it. The classifier recognises “clone X into Y” phrasing, and naming the enzymes pins the digest pair. Without explicit enzymes, Splicify scans the backbone’s MCS for a unique-cutter pair that is also absent from the insert.

Run the test restriction enzyme workflow for cloning GFP into pUC19.
[attached: pUC19_empty.gb]

What you'll get back

  • Selected enzyme pair, scored on MCS unique-cutter check + insert internal-cut check
  • Forward and reverse primers with the chosen sites tailed on
  • Synthesis-first manifest when no template exists for the insert (gBlock + ligation, no PCR)
  • Diagnostic restriction map of the assembled product
  • Annotated GenBank of the assembled plasmid (LLM-annotated, not the upload’s original features)

Example 4 — Site-directed mutagenesis

Upload a plasmid and describe the change. SDM understands amino-acid notation (Y66H, S65T, D10A), feature deletions (“delete the His-tag”, “remove the NLS”), terminus insertions (“insert FLAG at the N-terminus of eGFP”), and position-based edits (“delete bp 100–150”). Before resolving the target, Splicify re-annotates the input plasmid with the full pipeline so motifs (His-tag, FLAG, HA, V5, kozak, NLS, P2A/T2A/E2A/F2A) and CDS submodules are searchable even when they’re not in the uploaded file’s features.

Delete the His-tag from this plasmid.
[attached: pCMV_6xHis_GFP_demo.gb]

Example 5 — sgRNA Golden Gate

Annealed-oligo cloning of a 20-bp guide into a CRISPR vector. The handler picks the right Type IIs enzyme automatically (BsmBI for lentiCRISPR v2, BbsI for pX330) and shows the assembled plasmid annotated with the full pipeline — every feature on the backbone is visible, not just the guide cassette.

Design oligos to clone gRNA GAGTCCGAGCAGAAGAAGAA (EMX1) into lentiCRISPR v2 using Golden Gate assembly.
[attached: lentiCRISPR_v2_unannotated.gb]

Example 6 — Gateway cloning

Splicify scans uploaded plasmids for att sites to decide which is a donor (attP) and which carries the insert. The BP/LR product is always emitted as a downloadable GenBank, and the response viz shows the recombined plasmid with every feature annotated.

Design primers for insertion of GFP into pDONR221 using Gateway BP recombination.
[attached: pDONR221.gb]

Example 7 — Describe a plasmid

When you describe a plasmid in plain language without naming specific fragments, Splicify routes the request to the describe-a-plasmid handler. It builds an abstract spec from your description (host, modules, topology), runs a semantic search over a 7,256-plasmid corpus to find the closest existing foundation, and proposes deterministic edits to make it match your spec — primer-tail edits for inserts under 40 bp, synthesis fragments for 40 bp and above.

Make a mammalian expression vector for eGFP with PuroR selection.

What comes back

  • <plasmid_id>_foundation.gb — the top-hit plasmid from the corpus, freshly annotated
  • designed_plasmid.gb — the foundation edited to match your spec, re-annotated
  • workflow_trace.json — ranked retrieval hits, edit operations with rationale, and any spec gaps deferred to the orchestrator
  • Plasmid map of the designed plasmid in the viewer

The plasmid viewer

Every workflow that returns a plasmid renders it in the same viewer panel below the chat. The viewer is interactive — drag to select, double-click a feature to inspect it, and use the toolbar to add, edit, or import annotations. Selections persist across the circular and linear views.

Toolbar buttons

Upload .gbDrop in a GenBank or FASTA file to start a fresh viewer session — no chat round-trip needed.
Add Annotation (Selected)Drag-select a region in either viewer, then click to label it. Annotations are added to the in-memory plasmid; download the updated GenBank with Download GenBank (.gb).
Add / Change SequenceInsert sequence at the cursor, replace the current selection, or delete it. The viewer re-renders and shifts every annotation past the edit.
Import Annotation(s)Upload a CSV with name + sequence columns. Each sequence is mapped onto the loaded plasmid by exact match (forward + reverse strand, with circular wrap-around). Optional headers — type, location, length, description — show up in the same gene-card popup as KB hits. Max-mismatches knob lets you accept fuzzy hits for noisy guide / primer panels.
Annotate (LLM + CDS)Runs the full annotation pipeline: feature scan across six reference tiers, ORF + CDS submodule resolution, rule-based modules (lentiviral / AAV / Gateway / floxed / Pol III / selection cassettes), Pol II expression cassettes, and 2A polyprotein decomposition.
Scan Cloning FeaturesAdds the cloning-feature layer: every Type II / Type IIs cut site, every Gateway att site, and PCR-warning bars at problematic primer-binding regions. Used by the cloning workflows for unique-cutter selection.
Analyze PlasmidPost-assembly purpose inference — what does this plasmid do? Looks for module conflicts (duplicate nucleases, missing terminators) and produces a plain-English summary.
Download GenBank (.gb)Saves the current sequence + every annotation visible in the viewer — including ones you added in the session and any LLM-annotated features.
SeqViz / Circular toggleSwitches between the SeqViz library&rsquo;s detail view and the in-house circular renderer. Both share state; selections survive the toggle.

Selecting, editing, navigating

  • Drag in either viewer to select a range — the bp count and span are shown next to the toolbar.
  • Press Delete with a selection to remove that region from the sequence.
  • Double-click any feature to open its gene card: type, location, length, description, KB source, sequence (copy-pasteable).
  • Wheel-scroll the linear viewer for fine navigation; click anywhere on the circular to jump.
  • Cloning-feature glyphs (Type II / IIs brackets, Gateway att crossovers, PCR warnings) can be filtered by family + cutter count from the Cloning Features menu.

Tips that change the outcome